Exercices




S’entraîner en s’autoévaluant


7
La drépanocytose et la vigilance chez les femmes enceintes

Formuler et résoudre un problème scientifique

Les femmes atteintes de drépanocytose doivent être très attentives à leur santé lors de la grossesse car elles sont sujettes à des fausses couches (avortement naturel).

Globules rouges (MEB, images colorisées)

1 Globules rouges (MEB, images colorisées).

La drépanocytose est une maladie génétique affectant l’hémoglobine qui transporte le dioxygène dans le sang (dans les globules rouges). La présence d’une hémoglobine anormale déforme les globules et réduit le transport du dioxygène.

L’expression de l’hémoglobine dans l’organisme

2 L’expression de l’hémoglobine dans l’organisme.

Voir les réponses

Question

Justifiez la vigilance nécessaire auprès des femmes enceintes atteintes de cette maladie.

Coup de pouce

Positionnez-vous sur la grille d'évaluation et cliquez sur les points d'interrogation pour obtenir un coup de pouce permettant de passer au niveau supérieur.

drépanocytose coup de pouce
?
?
?
?

Résoudre un problème

Voir les réponses

Question

Déterminez quels sont les effets des UV sur notre organisme et identifiez pourquoi les autorités sanitaires envisagent d’interdire les cabines à UV. Votre production pourra prendre la forme d’un texte agrémenté de schémas, d’un poster ou d’un padlet.
Couleurs
Formes
Dessinez ici

Incidence du mélanome en France entre 1980 et 2010

4 Incidence du mélanome en France entre 1980 et 2010.


L’effet des UV sur l’ADN

2 L’effet des UV sur l’ADN.


9
Les UV et notre patrimoine génétique

Formuler et résoudre un problème scientifique

1 Quelques effets des UV.

Les rayons solaires génèrent chaleur et bien-être et stimulent la circulation sanguine. Les UV activent la production de vitamine D, nécessaire au squelette et au système immunitaire. En hiver, beaucoup d’individus ont des carences en vitamine D, mais quelques courtes expositions répétées au soleil pendant l’été suffisent à en produire assez.

5 Santé : le bronzage aux UV bientôt interdit ?

Le bronzage aux UV pourrait bientôt appartenir au passé. Alors que l’Agence nationale de sécurité sanitaire (Anses) souligne le risque élevé de cancer de la peau, elle demande « aux pouvoirs publics de prendre toute mesure de nature à faire cesser l’exposition de la population aux UV artificiels ».

Isabelle Choquet, « Santé : le bronzage aux UV bientôt interdit ? »,
RTL.fr, octobre 2018.

Étapes de formation du mélanome

3 Étapes de formation du mélanome.

Tester ses connaissances

Coup de pouce

Avant de vous lancer, il faut d’abord lister vos idées et les organiser, par exemple sur une carte mentale (au brouillon). Une fois cette carte mentale établie, vous pourrez construire un argumentaire logique et cohérent. Pensez également à produire un schéma sans oublier les légendes et le titre.
Voir les réponses

3
Construisez une phrase pour chaque série de mots proposée. Votre phrase doit utiliser tous les mots !

a. ADN - chaînes - double hélice - nucléotides - complémentarité.

b. nucléotides - séquence d’ADN - information génétique - gènes - allèles.

c. cellule spécialisée - génome - gènes - expression - variable.
Voir les réponses

4
Rédigez une courte synthèse sur le sujet suivant :

Les caractéristiques du support de l’information génétique permettant sa fonction de support informatif.
Votre réponse contiendra un schéma.

Couleurs
Formes
Dessinez ici
Voir les réponses

2
Vrai ou faux ? Parmi les propositions suivantes, identifiez la proposition fausse et corrigez-la.






Voir les réponses

1
Pour chaque proposition, choisissez la bonne réponse.

1. L’ADN :





2. Dans l’ADN, le nucléotide A est :





3. L’ADN est une molécule :





4. D’après ce document :





Cellules cancéreuses (microscopie à fluorescence).

Cellules cancéreuses (microscopie à fluorescence).

La fluorescence verte marque le produit d’expression d’un gène A, la fluorescence rouge celui d’un gène B et l’ADN est marqué en bleu.

5. Les gènes :



S’exercer de façon guidée


8
L’ADN du virus bactériophage

Formuler et résoudre un problème scientifique

Le bactériophage est un virus infectant des bactéries. Après fixation sur la bactérie, il lui injecte son ADN. Les gènes viraux sont alors exprimés par la bactérie, ce qui permet la formation de nouveaux virus et ce qui tue la bactérie infectée. Pourtant, certaines bactéries ne meurent pas et se divisent, produisant de nouvelles bactéries. Ces dernières se mettent parfois à produire des virus sans avoir été infectées.

Bactériophage T4 fixé à une bactérie

Bactériophage T4 (coloré en rouge) fixé à une bactérie (colorée en bleu).

Voir les réponses

Question

Expliquez pourquoi certaines bactéries produisent des virus sans avoir été infectées.


Extrait d’ADN de virus Extrait d’ADN de bactérieExtrait d’ADN de bactérie
ayant survécu à une infection
ATGACTATCAAAACTAAAGCTGAACTTTTGAA ATGATTTCAGGCATTTTAGCATCCCCGGGTAT ATGATTTCAGGCATTTTAGATGACTATCAAAAC

Coup de pouce

Choisissez un coup de pouce adapté au type de difficulté rencontré en cliquant sur la lettre correspondante:
  • Consigne (C)
  • Analyse des documents (A)
Coup de pouce
C
A
A

S’entraîner


Cliquez ici pour découvrir le principe des analyses ADN en vidéo.
Voir les réponses

Questions


1. Expliquez l’origine de l’albinisme.


2. Identifiez si le fœtus a un risque d’être albinos, en argumentant votre réponse.


3. Schématisez les 2 brins de l’ADN de la portion du gène du fœtus.

Couleurs
Formes
Dessinez ici
Voir les réponses

Questions

1. Expliquez l’intérêt des enzymes de restriction dans ce test.


2. Décrivez le profil ADN de Michael Jackson et comparez-le à celui de Paris, Prince et Blanket afin d’identifier si ceux-ci sont ses enfants biologiques.


Séquençage du gène de la tyrosinase chez un individu sain et chez le fœtus.

2 Séquençage du gène de la tyrosinase chez un individu sain [a] et chez le fœtus [b].

L’albinisme est une maladie génétique qui se manifeste par une absence du pigment brun de la peau : la mélanine. Les individus ont la peau, les cheveux et les poils très clairs. Elle est due à une mutation sur le gène de la tyrosinase. Ce gène permet la synthèse d’une enzyme qui transforme une molécule incolore en mélanine.

5
Leur fille sera-t-elle albinos ?

Interpréter des résultats et en tirer des conclusions

Un couple va bientôt avoir une petite fille. Les parents ne sont pas albinos mais leur famille est sujette à l’albinisme. Ils souhaitent savoir si leur fille sera albinos.

Une mère et ses deux enfants, dont un albinos

1 Une mère et ses deux enfants, dont un albinos.


6
Qui sont les enfants biologiques de Michael Jackson ?

Analyser des documents et en tirer des conclusions

Récemment, un procès a opposé la famille de Michael Jackson et AEG, le promoteur de la tournée « This Is It ». La société a exigé des tests de paternité afin de déterminer si Blanket, Prince et Paris étaient ses enfants biologiques.
Pour un tel test, on utilise des enzymes de restriction qui coupent l’ADN au niveau de séquences très précises, ce qui permet d’obtenir un nombre et une taille de fragments spécifiques d’un individu : c’est le profil ADN. Les individus proches (parents et enfants) ont des profils ADN identiques.

Principe et résultat du test de paternité

Principe et résultat du test de paternité.

A : fonctionnement de l’enzyme de restriction EcoR1 - B : séquence ADN du gène étudié chez Michael Jackson - C : résultats du test ADN utilisant EcoR1.
Connectez-vous pour ajouter des favoris

Pour pouvoir ajouter ou retrouver des favoris, nous devons les lier à votre compte.Et c’est gratuit !

Se connecter

Livre du professeur

Pour pouvoir consulter le livre du professeur, vous devez être connecté avec un compte professeur et avoir validé votre adresse email académique.

Votre avis nous intéresse !
Recommanderiez-vous notre site web à un(e) collègue ?

Peu probable
Très probable

Cliquez sur le score que vous voulez donner.

Dites-nous qui vous êtes !

Pour assurer la meilleure qualité de service, nous avons besoin de vous connaître !
Cliquez sur l'un des choix ci-dessus qui vous correspond le mieux.

Nous envoyer un message




Nous contacter?