Chargement de l'audio en cours
Plus

Plus

La biodiversité sur Terre
P.172-173

Mode édition
Ajouter

Ajouter

Terminer

Terminer

ACTIVITÉ DOCUMENTAIRE


1
La biodiversité sur Terre




La biodiversité terrestre résulte d’une longue histoire évolutive et comprend les trois échelles du vivant : écosystémique, spécifique et génétique. Si 1 700 000 espèces sont connues en 2019, on estime qu’il en existerait des millions, voire des milliards.

➜ Quelles méthodes permettent d’estimer la biodiversité terrestre ?



Doc. 1
Échantillonner la biodiversité spécifique

La richesse spécifique correspond au nombre d’espèces dans un milieu. Pour étudier cette biodiversité spécifique, les chercheurs disposent de plusieurs techniques comme les quadrats ou les transects. Un quadrat est une surface carrée ou rectangulaire au sol, dans laquelle un relevé exhaustif des espèces présentes est réalisé. Un transect est un trajet suivi dans un écosystème : on relève tous les êtres vivants observés en suivant ce transect. De 1997 à 1999, les chercheurs de la station alpine du Lautaret et du Laboratoire d’écologie alpine ont échantillonné soixante-quinze quadrats de 5 × 5 m au lieu-dit Avaro (commune de Valloire), dans le col du Galibier, une prairie alpine de 20 000 m2.

Échantillonner la biodiversité

Comparaison des espèces trouvées dans le col du Galibier (Alpes).


Quadrat

Photographie d’un quadrat délimitant une zone étudiée.

Réaliser un échantillonage de la biodiversité par quadrat ou par transect

L’objectif est de réaliser un échantillonnage lors d’une sortie scolaire.

Matériel nécessaire :

  • Quadrat (il peut être réalisé facilement à l’aide d’un cadre en bois sur lequel des fils sont tendus),
  • Clé d’identification des végétaux du milieu étudié. La plus précise possible et idéalement avec des photographies (exemple),
  • Appareil photo éventuellement.

Protocole :

Placer le quadrat au sol.
Relever toutes les espèces présentes dans chacun des carrés du quadrat.

Doc. 2
Aperçu de la biodiversité spécifique mondiale avec quelques groupes

Le nombre total d’espèces peut être extrapolé à partir du nombre d’espèces connues dans chaque taxon.
Les estimations dépendent des méthodes de calcul choisies. Pour des espèces plus difficiles à étudier (petite taille, évolution rapide, etc.) comme les bactéries, l’estimation de ce nombre est moins fiable. Les recherches menées vont dans le sens de plusieurs centaines de milliards d’espèces de bactéries.

Source : Mora C. et al., Plos Biology, 2011.


Taxon Nombre d’espèces décrites Nombre estimé d’espèces
Métazoaires (animaux) 1 124 516 9 920 000
Eumycètes (champignons) 44 368 616 320
Angiospermes
(plantes à fleurs)
224 244 314 600

Ressource complémentaire

Retrouvez des données détaillées sur la biodiversité en France en cliquant ici, et apprenez-en davantage sur l'impact de l'Homme sur les océans en cliquant ici.

Doc. 3
Des méthodes d’étude modernes de la biodiversité : barcoding moléculaire et metabarcoding

méthode de barcoding moléculaire

Principe de la méthode de barcoding moléculaire.

Le barcoding moléculaire consiste à identifier une espèce en comparant une courte séquence de son ADN à toutes les séquences connues d’ADN rassemblées dans une banque de données, comme si l’on « scannait » son code-barres génétique. En comparant toutes les séquences d’ADN retrouvées dans un échantillon d’eau ou de sol à cette banque de données, les chercheurs peuvent identifier les espèces qui se trouvent dans cet échantillon : c’est le metabarcoding. Ces méthodes sont cependant coûteuses et ne peuvent pas remplacer complètement les reconnaissances sur le terrain.
De 2009 à 2013, les équipes de recherche à bord du Tara ont réalisé une étude approfondie par metabarcoding de la diversité des microorganismes marins. La carte ci-dessous présente l’abondance relative des différents taxons dans trois des lieux étudiés.

Expédition Tara


L’expédition Tara Océan : un exemple de metabarcoding.

Ressource complémentaire

Découvrez une vidéo de la Fondation Tara Océan sur la biodiversité et le séquençage ADN :
Noëlie Pansiot / Fondation Tara Océan

Cliquez ici pour visionner une vidéo de #DATAGUEULE sur la biodiversité.

Déterminer la biodiversité spécifique dans une station de l'océan Indien

Matériel nécessaire :

  • Fichier de séquences :
    • 41 % de Taxon n° 1 (dinophytes) :
      CGCTGGCGGCATGCTTAACACATGCAAGTCGAACGGTAACAGGTCTAGCTTGCTAGATGCTGACGAGTGGCGGACG-GGTGAGTAACGCGTAGGAATCTACCCCGCGGTGGGGGATAACACGAGGAAACTCGTGCTAATACCGCATACGCTCTA-CGGAGGAAAATTTTTTTGCCGTGGGATGAGCCTGCGTTAGATTAGCTTGTTGGTGGGGTAATGGCCTACCAAGGCGAT-GATCTATAGCTGTTCTGAGAGGAAGATCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCA-GTGGGGAATCTTGGACAATGGGGGAAACCCTGATCCAGCAATGCCGCGTGTGTGAAGAAGGCCTGCGGGTTGTAAA
    • 21 % de Taxon n° 2 (bactéries) :
      GAGCAGTGCGCTCTCCTGGTGGACGGTTTCGTGGCTGGCCCCACGGCCGTGGCGACAGCGCGCCGCAACTTCCCC-CGTCAGTGGCTGCACTACCATCGCGCCGGCCACGGCATGATCACCTCCCCCCAGACCCAGCGAGGCTACACCGCCC-TGGTACTCTCCAAGTTCTCGCGATTGCTCGGCTCGTCGGGTATCCACGTCGGCACCATGGGCTTCGGCAAGNTGGAGTC
    • 12 % de Taxon n° 3 (straménopiles) :
      TAGTTGGTGGAGCGATTTGTCTGGTTAATTCCGTTAACGAACGAGACCACAGGGTTTTATTCTTTTCTTTTTATG-TAAATAAGAATGTTTTATGTAGATTAAACCGACTTTTAATTCTTTAAATTAAAGGAAGTTTGTGGCAATAACAGGTC
  • Logiciel de Basic Local Alignment Search Tool (exemple),
  • Ordinateur connecté à internet.

Protocole :

Aller sur le site qui permet d’aligner des séquences avec une banque de séquences identifiées.
Sélectionner « Nucleotide BLAST » (Blast de fragment d’ADN).
Dans le cadre « Enter accession number(s), gi(s), or FASTA sequence(s) », coller ou recopier votre séquence d’ADN à identifier.
Cliquer sur « BLAST ».
Noter le nom du taxon identifié à 100 %.
Recommencer avec les autres séquences.

Vocabulaire

Espèce (définition phylogénétique) : ensemble d’êtres vivants partageant une combinaison unique de caractères (morphologiques et/ou moléculaires).

Taxon : groupe d’êtres vivants (espèce, famille, ordre, etc.).

Questions

1. Doc. 1 (⇧) Comparer la diversité spécifique des deux quadrats du Galibier et proposer une explication aux différences observées.


2. Doc. 2 (⇧) Tracer un diagramme circulaire donnant l’abondance relative de chaque taxon du tableau. Y représenter la partie connue de chaque taxon. Commenter le résultat.
Lancer le module Geogebra
Vous devez vous connecter sur GeoGebra afin de sauvegarder votre travail

3. Doc. 3 (⇧) Comparer et commenter la richesse taxonomique des différents lieux échantillonnés lors de l’expédition Tara Oceans.


4. Doc. 1 (⇧), Doc. 2 (⇧) et Doc. 3 (⇧) Discuter de la complémentarité des différentes méthodes d’étude de la biodiversité.
Voir les réponses
Utilisation des cookies
En poursuivant votre navigation sans modifier vos paramètres, vous acceptez l'utilisation des cookies permettant le bon fonctionnement du service.
Pour plus d’informations, cliquez ici.