Enseignement scientifique Terminale
Rejoignez la communauté !
Co-construisez les ressources dont vous avez besoin et partagez votre expertise pédagogique.
Thème 1 : Science, climat et société
Introduction
Ch. 1
L'atmosphère terrestre et la vie
Ch. 2
La complexité du système climatique
Ch. 3
Le climat du futur
Ch. 4
Énergie, développement et futur climatique
Objectif Bac : Thème 1
Thème 2 : Le futur des énergies
Introduction
Ch. 5
Deux siècles d’énergie électrique
Ch. 6
Les atouts de l’électricité
Ch. 7
Optimisation du transport de l’électricité
Ch. 8
Choix énergétiques et impacts
Objectif Bac : Thème 2
Thème 3 : Une histoire du vivant
Introduction
Ch. 9
La biodiversité et son évolution
Ch. 10
L’évolution, une grille de lecture du monde
Ch. 11
L’évolution humaine
Ch. 12
Les modèles démographiques
Ch. 13
De l’informatique à l’intelligence artificielle
Objectif Bac : Thème 3
Livret maths
Fiches méthode
Annexes
Chapitre 9
Activité 1 - documentaire

La biodiversité sur Terre

Introduction
La biodiversité terrestre résulte d'une longue histoire évolutive et comprend les trois échelles du vivant : écosystémique, spécifique et génétique. Si 1 700 000 espèces sont connues en 2019, on estime qu'il en existerait des millions, voire des milliards.

Quelles méthodes permettent d'estimer la biodiversité terrestre ?

Documents

Doc. 1
Échantillonner la biodiversité spécifique

La richesse spécifique correspond au nombre d'espèces dans un milieu. Pour étudier cette biodiversité spécifique, les chercheurs disposent de plusieurs techniques comme les quadrats ou les transects. Un quadrat est une surface carrée ou rectangulaire au sol, dans laquelle un relevé exhaustif des espèces présentes est réalisé. Un transect est un trajet suivi dans un écosystème : on relève tous les êtres vivants observés en suivant ce transect. De 1997 à 1999, les chercheurs de la station alpine du Lautaret et du Laboratoire d'écologie alpine ont échantillonné soixante-quinze quadrats de 5 × 5 m au lieu-dit Avaro (commune de Valloire), dans le col du Galibier, une prairie alpine de 20 000 m2.
Échantillonner la biodiversité
Le zoom est accessible dans la version Premium.
Crédits : lelivrescolaire.fr/Google Maps
Comparaison des espèces trouvées dans le col du Galibier (Alpes).
Quadrat
Le zoom est accessible dans la version Premium.
Crédits : Martyn F. Chillmaid/SPL/Biosphoto
Photographie d'un quadrat délimitant une zone étudiée.

Travaux pratiques

Réaliser un échantillonage de la biodiversité par quadrat ou par transect


L'objectif est de réaliser un échantillonnage lors d'une sortie scolaire.

Protocole :
  • Placer le quadrat au sol.
  • Relever toutes les espèces présentes dans chacun des carrés du quadrat.

Matériel nécessaire :

Doc. 2
Aperçu de la biodiversité spécifique mondiale avec quelques groupes

Le nombre total d'espèces peut être extrapolé à partir du nombre d'espèces connues dans chaque taxon.
Les estimations dépendent des méthodes de calcul choisies. Pour des espèces plus difficiles à étudier (petite taille, évolution rapide, etc.) comme les bactéries, l'estimation de ce nombre est moins fiable. Les recherches menées vont dans le sens de plusieurs centaines de milliards d'espèces de bactéries.
Source : Mora C. et al.
Plos Biology, 2011.

TaxonNombre d'espèces décritesNombre estimé d'espèces
Métazoaires (animaux)1 124 5169 920 000
Eumycètes (champignons)44 368616 320
Angiospermes
(plantes à fleurs)
224 244314 600

Doc. 3
Des méthodes d'étude modernes de la biodiversité : barcoding moléculaire et metabarcoding

méthode de barcoding moléculaire
Le zoom est accessible dans la version Premium.
Principe de la méthode de barcoding moléculaire.

Le barcoding moléculaire consiste à identifier une espèce en comparant une courte séquence de son ADN à toutes les séquences connues d'ADN rassemblées dans une banque de données, comme si l'on « scannait » son code-barres génétique. En comparant toutes les séquences d'ADN retrouvées dans un échantillon d'eau ou de sol à cette banque de données, les chercheurs peuvent identifier les espèces qui se trouvent dans cet échantillon : c'est le metabarcoding. Ces méthodes sont cependant coûteuses et ne peuvent pas remplacer complètement les reconnaissances sur le terrain.
De 2009 à 2013, les équipes de recherche à bord du Tara ont réalisé une étude approfondie par metabarcoding de la diversité des microorganismes marins. La carte ci-dessous présente l'abondance relative des différents taxons dans trois des lieux étudiés.
Expédition Tara
Le zoom est accessible dans la version Premium.
L'expédition Tara Océan : un exemple de metabarcoding.

Travaux pratiques

Déterminer la biodiversité spécifique dans une station de l'océan Indien

Matériel nécessaire :
  • Fichier de séquences :
    • 41 % de Taxon n° 1 (dinophytes) :
      CGCTGGCGGCATGCTTAACACATGCAAGTCGAACGGTAACAGGTCTAGCTTGCTAGATGCTGACGAGTGGCGGACGGGTGAGTAACGCGTAGGAATCTACCCCGCGGTGGGGGATAACACGAGGAAACTCGTGCTAATACCGCATACGCTCTACGGAGGAAAATTTTTTTGCCGTGGGATGAGCCTGCGTTAGATTAGCTTGTTGGTGGGGTAATGGCCTACCAAGGCGATGATCTATAGCTGTTCTGAGAGGAAGATCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTGGGGAATCTTGGACAATGGGGGAAACCCTGATCCAGCAATGCCGCGTGTGTGAAGAAGGCCTGCGGGTTGTAAA
    • 21 % de Taxon n° 2 (bactéries) :
      GAGCAGTGCGCTCTCCTGGTGGACGGTTTCGTGGCTGGCCCCACGGCCGTGGCGACAGCGCGCCGCAACTTCCCC-CGTCAGTGGCTGCACTACCATCGCGCCGGCCACGGCATGATCACCTCCCCCCAGACCCAGCGAGGCTACACCGCCC-TGGTACTCTCCAAGTTCTCGCGATTGCTCGGCTCGTCGGGTATCCACGTCGGCACCATGGGCTTCGGCAAGNTGGAGTC
    • 12 % de Taxon n° 3 (straménopiles) :
      TAGTTGGTGGAGCGATTTGTCTGGTTAATTCCGTTAACGAACGAGACCACAGGGTTTTATTCTTTTCTTTTTATG-TAAATAAGAATGTTTTATGTAGATTAAACCGACTTTTAATTCTTTAAATTAAAGGAAGTTTGTGGCAATAACAGGTC

  • Logiciel de Basic Local Alignment Search Tool (),
  • Ordinateur connecté à internet.

Protocole :
  • Aller sur le qui permet d'aligner des séquences avec une banque de séquences identifiées.
  • Sélectionner « Nucleotide BLAST » (Blast de fragment d'ADN).
  • Dans le cadre « Enter accession number(s), gi(s), or FASTA sequence(s) », coller ou recopier votre séquence d'ADN à identifier.
  • Cliquer sur « BLAST ».
  • Noter le nom du taxon identifié à 100 %.
  • Recommencer avec les autres séquences.

Supplément numérique

Découvrez une vidéo de la Fondation Tara Océan sur la biodiversité et le séquençage ADN :
Visionner une de #DATAGUEULE sur la biodiversité.

Vocabulaire

  • Espèce (définition phylogénétique) : ensemble d'êtres vivants partageant une combinaison unique de caractères (morphologiques et/ou moléculaires).

  • Taxon : groupe d'êtres vivants (espèce, famille, ordre, etc.).

Questions


1. Doc. 1 Comparer la diversité spécifique des deux quadrats du Galibier et proposer une explication aux différences observées.

2. Doc. 2 Tracer un diagramme circulaire donnant l'abondance relative de chaque taxon du tableau. Y représenter la partie connue de chaque taxon. Commenter le résultat.
Logo Geogebra

GeoGebra

Vous devez vous connecter sur GeoGebra afin de sauvegarder votre travail


3. Doc. 3 Comparer et commenter la richesse taxonomique des différents lieux échantillonnés lors de l'expédition Tara Oceans.

4. Doc. 1, Doc. 2 et Doc. 3 Discuter de la complémentarité des différentes méthodes d'étude de la biodiversité.

Une erreur sur la page ? Une idée à proposer ?

Nos manuels sont collaboratifs, n'hésitez pas à nous en faire part.

Oups, une coquille

j'ai une idée !

Nous préparons votre pageNous vous offrons 5 essais
collaborateur

collaborateurYolène
collaborateurÉmilie
collaborateurJean-Paul
collaborateurFatima
collaborateurSarah

Premium activé


5
essais restants
Utilisation des cookies
Lors de votre navigation sur ce site, des cookies nécessaires au bon fonctionnement et exemptés de consentement sont déposés.